#FightLikeAMother – GenX Women Reclaim an Archetype and Change American Politics

On January 20th and 21st, women led millions once again to take to the streets. From tiny Walla Walla, Wash., to St. Petersburg, Fla., to the major cities of New York and Los Angeles, citizens of all ages and backgrounds carried signs calling for a return to logic and compassion.

On my sign were the words, “Fight Like a Mother.”

One of the cultural shifts of the past few years has been the reclamation of word definitions. Boomer women are enjoying a reclamation of the word “feminism” away from the Alt-Right shock jocks who for years scared people away from Femi-Nazis. Millennial led campaigns include #BanBossy and #FightLikeAGirl.

Some cancer awareness and fitness campaigns now use the hashtag #FightLikeAMother, but strangely it is almost never viewed in a political context. #MomsDemandAction and groups like them may help change that though.

Generation X women are reclaiming not only the word “Mother,” but the archetype as well.

Archetypes abound in art, film and literature as unconscious projections that serve to embody central societal and developmental struggles. This form of myth-making reflects our psychological and cultural attempts to fit (or trap) people neatly into understandable boxes.

The Mother archetype has always been one fraught with contradictions. The positive view of the archetypal Great Mother is pure and good and kind. Sweet and self sacrificing. Ever suffering and worrying. As American as Mom and apple pie, so to speak. Conversely, the negative side is the Mother demonized as emotional, controlling, bitter. Lost somewhere in the experience, is the feeling that surprises many modern women that they suddenly must justify themselves individually and culturally relevant.

“These are three essential aspects of the mother: her cherishing and nourishing goodness, her orgiastic emotionality, and her Stygian depths.” —Carl Jung, Four Archetypes

Just as women have been reclaiming the other archetype for women of a certain age, the Crone wise elder woman, we are also reclaiming our definition of what it means to be The Great Mother.

Modern mothers maintain vigilant focus on current and future facing issues of safety, health, education and opportunity not only for their families but also for themselves. Mothers also instinctively exemplify the collaborative leadership mindset that, “it takes a village to raise a child.” This is true whether or not they are single parents.

These shared core values shape American mothers’ worldview, politics, and actions.

The assault on those core values is one reason we have seen so many middle-aged Generation X mothers getting involved in politics and activism at the busiest time in our lives. Despite being often overwhelmed with the competing needs of career, children, health and caregiving for aging Boomer parents, GenX women are making time for political activism.

As I have been writing for several years, overlooking the issues important to Gen X is an obvious oversight. As the small and oft forgotten age cohort sandwiched between Boomers and Millennials, the two largest generations in human history, Xers are the up and coming generation of senior leaders for the coming decade.

An analogy would be senior middle managers preparing to take over from retiring executives. It will not be the millennial 20 and 30-somethings who will next assume the reigns, it will be those now between the ages of 40-55. Gen Xers.

American Xers were the first generation raised after the Women’s Movement. This meant many were taught to believe girls would have the same rights and opportunities as boys. Although that has not turned out to be the case, the underlying belief in the idealism of equality and meritocracy offers insight for our coming time at the head of the table.

Gen X women, many of us mothers and some even now young grandmothers, are changing narratives and uniting people around common core American values for the future. We are the ones who created the Mom Blog genre for sharing nontraditional mothering topics on everything from post party depression to secular homeschooling and community activism. The worldview of our age cohort of women, especially the very different experiences we have had as Mother Leaders, will leave a lasting imprint on American society.

Gen X mothers are less interested in ensuring that every child gets a trophy and more interested in making sure that our children will have a planet to live on in the future, clean water to drink, a quality education and the opportunity to find a good paying job.

But, we are most immediately concerned with their every day safety.

Contrary to the claim from the Trump administration after the 11th school shooting in 23 days, gun violence is not the result of some Obama era “domestic abuse” crime wave. This heightened concern for children’s safety is a result of the epidemic that has been threatening our children for two decades since the Columbine attack in 1999.

Almost 300 school shootings have occurred since 2013. 

If there was ever an issue in need of bipartisan solution, it is the epidemic of school shootings. Done waiting for the right time to deal with gun control, and as the most educated generation of mothers in American history, Gen X mothers began to assume activist roles in the leadership vacuum of “thoughts and prayers.”

Mother-led organizations have been working to raise awareness and bring people together to finally solve this shameful feature of modern American life for the past five years. These generational leaders are defining how to “fight like a mother.”

As explained on their website, just as Mothers Against Drunk Driving formed to reduce drunk driving, Moms Demand Action for Gun Sense in America formed to demand action from state and federal legislators, companies, and educational institutions to establish common-sense gun reforms. The organization was founded by stay-at-home mom Shannon Watts in 2012 after the shooting at Sandy Hook Elementary School that shocked the nation.

In just a few short years, it has grown to include chapters in all 50 states and a powerful grassroots network of mother activists that have successfully effected change at the local, state and national level by forging collaborative efforts across the political spectrum.

Bipartisan solutions are created when you collaborate from shared goals. 

As part of Everytown for Gun Safety, a movement of Americans working together to end gun violence and build safer communities, more than 4 million mayors, moms, cops, teachers, survivors, gun owners, and everyday Americans have come together to make their own communities safer.

This collaborative skill set is now being expertly applied on a multitude of issues by mothers turned protesters of the current administration. It is a skill set that will be even better used as more women run for and assume elected office.

Bipartisan alliances formed to end this shameful national epidemic will help to shape the future of GenX political leadership for years to come. Collaborators on one issue will be more easily approached for work on another. The same women fighting for sensible gun reform today will be well prepared to tackle the pressing issues facing our country with a network of community spirit.

And, good mothers that we Gen Xers are, we will mentor the girls that follow to keep on fighting like a mother for many generations to come.

Contributing Editor: Gayla Schaefer

Gayla Schaefer, MPA is a freelance writer and communications consultant with degrees in political science and public administration. Her research and writing has been published or republished by the Associated Press, IGI Global, and Gannett News publications. She lives in the Tampa Bay metro with her husband and twin boys. Follow her on Twitter at @DharmaMum

27 Comments

  • Angela Lacy
    Posted February 7, 2018 9:50 pm 0Likes

    Phenomenalllll article! Spot on!!

  • Micheline Aliberti
    Posted February 7, 2018 11:17 pm 0Likes

    This post is truly a fastidious one it helps new the web viewers, who
    are wishing for blogging.

  • Leigh
    Posted February 14, 2018 12:07 am 0Likes

    Amazing article! So well written, timely and important. This is the stuff that matters.

  • taneli
    Posted February 14, 2018 7:52 am 0Likes

     suis xerS gene with its native promoter was amplified using SsuisXerCFullFwd (CAAACCGCATTGCTCTGCCG) and SsuisXerCFullRev (GGACCAGTACCCAGCAGTC). An internal sequence of the xerS gene was amplified using the primers: SSXerCinF (CTATGAATTCGGGAGCGTCCCTTGCT) and ALK cancer SSXerCinR (CTTCGAATTCGGCAGACCACGGTATTCG).

  • Barneyxcq
    Posted February 17, 2018 1:33 pm 0Likes
  • P2000 Brandweer
    Posted February 26, 2018 6:37 am 0Likes

    Youre so cool! I dont suppose Ive read anything like this before. So nice to find any individual with some authentic ideas on this subject. realy thank you for beginning this up. this website is something that is wanted on the internet, someone with a little originality. useful job for bringing one thing new to the internet! http://www.brand-weer.nu/

  • spanisch lernen
    Posted March 2, 2018 11:08 pm 0Likes

    Oh my goodness! a tremendous article dude. Thank you However I’m experiencing problem with ur rss . Don’t know why Unable to subscribe to it. Is there anybody getting similar rss drawback? Anybody who is aware of kindly respond. Thnkx

  • Deposits plugin
    Posted March 4, 2018 7:30 pm 0Likes

    This is the suitable blog for anybody who wants to search out out about this topic. You realize so much its virtually hard to argue with you (not that I truly would need…HaHa). You undoubtedly put a brand new spin on a subject thats been written about for years. Nice stuff, simply great!

  • Free Robux No Human verification
    Posted March 6, 2018 11:42 am 0Likes

    Thank you, I have just been looking for info approximately this topic for
    a while and yours is the greatest I’ve found out till now.

    But, what in regards to the bottom line? Are you sure concerning
    the supply?

  • ALPEREN
    Posted March 7, 2018 3:10 am 0Likes

    Quality blog brings quality monitoring and changes mind of intelects.A small donation you may be interested. http://corneey.com/wm6Zo9

  • P2000
    Posted March 7, 2018 5:32 pm 0Likes

    I know top Blog professionals would really like your blog. You have a good head on your shoulders. You always know just what to say. I truly appreciate this page. Neat post.

  • bitcoin miner
    Posted March 15, 2018 4:05 pm 0Likes

    There is noticeably a bundle to know about this. I assume you made sure good points in options also.

  • Fallout 4 Cheats
    Posted March 25, 2018 10:14 am 0Likes

    Thank you, I have just been looking for info approximately this topic for
    a while and yours is the greatest I’ve found out till now.

    But, what in regards to the bottom line? Are you sure concerning
    the supply?

  • presurizador de pelotas
    Posted March 28, 2018 6:59 am 0Likes

    You made some decent points there. I regarded on the internet for the difficulty and found most individuals will associate with along with your website.

  • Free robux
    Posted March 31, 2018 11:22 am 0Likes

    Oh my goodness! a tremendous article dude. Thank you However I’m experiencing problem with ur rss . Don’t know why Unable to subscribe to it. Is there anybody getting similar rss drawback? Anybody who is aware of kindly respond. Thnkx

  • Free robux
    Posted March 31, 2018 1:58 pm 0Likes

    Thank you, I have just been looking for info approximately this topic for
    a while and yours is the greatest I’ve found out till now.

    But, what in regards to the bottom line? Are you sure concerning
    the supply?

  • Plumbing Atlanta Ga
    Posted April 1, 2018 7:11 am 0Likes

    A formidable share, I simply given this onto a colleague who was doing just a little analysis on this. And he in reality bought me breakfast as a result of I discovered it for him.. smile. So let me reword that: Thnx for the treat! However yeah Thnkx for spending the time to debate this, I feel strongly about it and love studying extra on this topic. If possible, as you develop into expertise, would you mind updating your blog with more particulars? It’s extremely helpful for me. Large thumb up for this blog publish!

  • alquiler de carros cali
    Posted April 1, 2018 7:18 am 0Likes

    Youre so cool! I dont suppose Ive read anything like this before. So nice to find any individual with some authentic ideas on this subject. realy thank you for beginning this up. this website is something that is wanted on the internet, someone with a little originality. useful job for bringing one thing new to the internet!

  • anna university student login
    Posted April 4, 2018 11:45 pm 0Likes

    Thank you, I have just been looking for info approximately this topic for
    a while and yours is the greatest I’ve found out till now.

    But, what in regards to the bottom line? Are you sure concerning
    the supply?

  • free instagram followers
    Posted April 8, 2018 4:35 am 0Likes

    You made some decent points there. I regarded on the internet for the difficulty and found most individuals will associate with along with your website.

  • free instagram followers
    Posted April 8, 2018 2:23 pm 0Likes

    I know top Blog professionals would really like your blog. You have a good head on your shoulders. You always know just what to say. I truly appreciate this page. Neat post.

  • free instagram followers no human verification
    Posted April 10, 2018 2:42 am 0Likes

    I’d need to test with you here. Which is not one thing I normally do! I get pleasure from studying a put up that may make people think. Additionally, thanks for permitting me to remark!

  • Grasscity
    Posted April 10, 2018 3:24 pm 0Likes

    There is noticeably a bundle to know about this. I assume you made sure good points in options also.

  • Mix and Match Products Extension
    Posted April 10, 2018 3:45 pm 0Likes

    There is noticeably a bundle to know about this. I assume you made sure good points in options also.

  • instagram likes
    Posted April 12, 2018 4:48 pm 0Likes

    There are some attention-grabbing cut-off dates in this article however I don’t know if I see all of them heart to heart. There may be some validity however I will take maintain opinion until I look into it further. Good article , thanks and we would like extra! Added to FeedBurner as well

  • superstar bts hack
    Posted April 17, 2018 1:25 pm 0Likes

    You made some decent points there. I regarded on the internet for the difficulty and found most individuals will associate with along with your website.

  • hire freelancer
    Posted April 25, 2018 7:46 pm 0Likes

    A formidable share, I simply given this onto a colleague who was doing just a little analysis on this. And he in reality bought me breakfast as a result of I discovered it for him.. smile. So let me reword that: Thnx for the treat! However yeah Thnkx for spending the time to debate this, I feel strongly about it and love studying extra on this topic. If possible, as you develop into expertise, would you mind updating your blog with more particulars? It’s extremely helpful for me. Large thumb up for this blog publish!

Add Comment